您当前的位置:首 页 - 学术交流 - 详细内容
The cancer/testis antigen HORMAD1 promot 浏览:1 发布人:admin 2023/04/13/20:59
Am J Transl Res 2023;15(9):5808-5825
www.ajtr.org /ISSN:1943-8141/AJTR0151608
Original Article
The cancer/testis antigen HORMAD1 promotes
gastric cancer progression by activating the
NF-κB signaling pathway and inducing
epithelial-mesenchymal transition
Geng Bian1,2, Weiyu Li3,4, Dabing Huang5 , Qi Zhang6 , Xiping Ding7 , Xiaodong Zang8 , Yingquan Ye1,2, Jie Cao9 ,
Ping Li1,2
1
Department of Chinese Integrative Medicine Oncology, The First Affiliated Hospital of Anhui Medical University,
Hefei 230022, Anhui, China; 2Department of Integrated Traditional Chinese and Western Medicine, Anhui
Medical University, Hefei 230022, Anhui, China; 3National Clinical Research Center of Digestive Diseases, Beijing
100050, China; 4Liver Research Center, Beijing Key Laboratory of Translational Medicine in Liver Cirrhosis,
Beijing Friendship Hospital, Capital Medical University, Beijing 100050, China; 5Department of Oncology, The
First Affiliated Hospital of USTC, Division of Life Sciences and Medicine, University of Science and Technology of
China, Hefei 230001, Anhui, China; 6Department of Urology, The First Affiliated Hospital of USTC, Division of Life
Sciences and Medicine, University of Science and Technology of China, Hefei 230001, Anhui, China; 7Department
of Geriatrics, The First Affiliated Hospital of USTC, Division of Life Sciences and Medicine, University of Science
and Technology of China, Hefei 230001, Anhui, China; 8Department of Pediatrics, The First Affiliated Hospital
of USTC, Division of Life Sciences and Medicine, University of Science and Technology of China, Hefei 230001,
Anhui, China; 9Department of Respiratory, The First Affiliated Hospital of USTC, Division of Life Sciences and
Medicine, University of Science and Technology of China, Hefei 230001, Anhui, China
Received June 6, 2023; Accepted September 12, 2023; Epub September 15, 2023; Published September 30,
2023
Abstract: Objectives: HORMAD1 is a cancer/testis antigen (CTAs) that regulates DNA homologous recombina
tion, mismatch repair, and other tumor characteristics. However, its role and regulatory mechanisms in gastric
cancer remain unclear. Methods: We performed transcriptomic profiling on seven gastric cancers and paired tis
sues; HORMAD1 was significantly upregulated in gastric cancer samples and was related to poor prognosis sur
vival. Furthermore, cancer pathway microarray, bioinformatic analysis, western blot, and immunochemistry assay
demonstrated that HORMAD1 affected the NF-κB signaling pathway. Results: In vitro and vivo studies confirmed
that HORMAD1 knockdown inhibited cell growth and invasion, whereas overexpression reversed these effects.
Mechanistically, HORMAD1 regulates the epithelial-mesenchymal transition process (EMT) via the NF-κB pathway
by increasing the phosphorylation levels of NF-κB (p-65) and Iκκ-β. Downstream target genes of the NF-κB signal
ing pathway, such as c-Myc, CyclinD1, may be involved in HORMAD1-induced tumorigenesis in gastric cancer (GC).
Conclusions: HORMAD1 plays an important role in gastric cancer progression and could be a promising prognostic
biomarker and therapeutic target.
Keywords: HORMAD1, gastric cancer, cell proliferation, migration and invasion, NF-κB signaling pathway
Introduction
Gastric cancer (GC) is the fifth most common
cancer and the third leading cause of cancer
death globally. In East Asian countries, espe
cially China, the incidence of GC is as high as
42% [1, 2]. Presently, the diagnosis and treat
ment of gastric tumors have been greatly im
proved with advances in diagnostic and surgi
cal techniques [3]. However, because of the low
early diagnosis rate, most patients are diag
nosed at an advanced GC stage, leading to a
30-50% five-year mortality rate [4]. Therefore,
exploring the mechanisms underlying GC pro-HORMAD1 promotes gastric cancer progression
5809
Am J Transl Res 2023;15(9):5808-5825
gression and identifying novel therapeutic tar
gets and biomarkers for diagnosis and treat
ment is vital.
Studies suggest that the NF-κB signaling path
way has been widely demonstrated as one of
the most commonly activated and essential
pathways for EMT and GC progression [5, 6].
Moreover, NF-κB as a transcription factor has
also been identified in many cancers and is
thought to promote tumor progression [7].
Furthermore, several studies have suggested
the activation of the transcription factor NF-κB
by numerous regulatory proteins involved in cell
cycle, proliferation, apoptosis, and migration
[8] that is composed of two distinct subunits
(p50 and p65) and is subject to regulation at
multiple levels [9]. Under normal conditions,
NF-κB remains inactive in the cytoplasm due to
its binding with inhibitor proteins known as IκBs
[10]. Upon activation, phosphorylation of the
inhibitor by IκB kinase (IKK) triggers the degra
dation of IκB-α, allowing the NF-κB subunit p65
to translocate to the nucleus, where it induces
its transcriptional activity [11]. Thus, activating
the NF-κB signaling pathway plays an important
role in tumor progression; however, the molecu
lar function of NF-κB activation in GC remains
unclear.
HORMAD1 was originally identified as cancer/
testis antigen (CTA46), a member of the CTAs
family, normally expressed in the testes and
diverse cancers [12]. HORMAD1, like other
CTAs proteins, participates in tumor initiation,
progression, metastasis, and drug resistance
and is closely correlated with poor prognosis.
For instance, previous studies have shown
that HORMAD1 promotes EMT and enhances
growth and metastasis through the Wnt signal
ing pathway in lung cancer [13]. Another study
found that HORMAD1 can induce chemo
resistance and radioresistance by promoting
homologous recombination to ensure DNA
damage repair in lung adenocarcinoma [14,
15]. Moreover, compelling evidence shows that
HORMAD1 expression and poor prognosis are
associated with increased mutation load and
genomic instability in many cancers [12, 16].
Furthermore, reports have indicated that the
down-regulation of HORMAD1 enhances apop
tosis when combined with docetaxel, leading to
reduced levels of VEGF protein and microvessel
density in human epithelial ovarian cancer both
in vivo and in vitro [17]. Recently, it has been
indicated that HORMAD1 is an independent
prognostic factor in triple-negative breast can
cers with cyclophosphamide treatment [18].
Notably, it has also been documented that
HORMAD1 was over-expressed in > 45% of GC
specimens tested [19]. However, the role of
HORMAD1 in gastric cancer growth and pro
gression and the potential underlying mecha
nism has not been investigated.
In our study, we focused on the clinical impor
tance and biological function of HORMAD1
in GC. Using RNA-seq, we discovered that
HORMAD1 was significantly up-regulated in GC
tissues and confirmed by the TCGA database to
be associated with a poor prognosis. Further
experiments showed that HORMAD1 had a
higher expression in GC tissues and cell lines.
Additionally, loss- and gain-of-function demon
strated that HORMAD1 promotes the prolifera
tion, migration, and invasion of GC cells in vitro
and in vivo. Mechanistically, HORMAD1 pro
motes EMT and GC progression through acti
vating the NF-κB signaling pathway.
Materials and methods
Clinical tissue collection
In this study, 46 GC tissue samples and
matched normal adjacent gastric tissues were
studied at the First Affiliated Hospital of USTC,
University of Science and Technology of China
(USTC), from 2019 to 2021, and none of the
patients were treated with any preoperative
therapy. All patients provided written informed
consent for the clinical research use of their
tumor tissues. This study was approved by
the Ethics Committee of USTC (No. 2019-X(H)-
001).
RNA-sequencing
RNA-seq analysis of cells and tissue samples
was performed by Gene Denovo Biotechnology
Co. (Guangzhou, China). RNA was purified and
fragmented to construct the RNA-seq library
for sequencing. The cDNA fragments were
purified using a QiaQuick PCR extraction kit.
After agarose gel electrophoresis, suitable
fragments were used as templates for PCR
amplification. Real-time PCR was used to char
acterize the sample library. Finally, the library
was sequenced using Illumina HiSeq™ 4000.HORMAD1 promotes gastric cancer progression
5810
Am J Transl Res 2023;15(9):5808-5825
Analysis of HORMAD1 gene expression and
Kaplan-Meier survival analysis based on The
Cancer Genome Atlas database
HORMAD1 gene expression data were ob
tained from The Cancer Genome Atlas (TCGA,
http://tcgadata.nci.nih.gov/tcga/). To evaluate
the effect of HORMAD1 expression on survival,
we conducted Kaplan-Meier analysis and gen
erated corresponding survival curves, hazard
ratios (HRs), 95% confidence interval (CIs), and
log-rank p-values (p) using the Kaplan-Meier
plotter (http://kmplot.com) platform.
Immunohistochemical staining
For patient tissues, Immunohistochemical (IHC)
staining was performed following standard pro
tocols [20]. The percentage of positive cells
was scored as follows: 0 (negative), 1 (≤ 10%),
2 (> 10%-50%), 3 (> 50%-80%), and 4 (> 80%).
Staining intensity was rated as 0 (negative), 1
(weak), 2 (moderate), or 3 (strong). The target
protein expression was determined using the
following criteria: low (score < 6) and high (score
≥ 6). As previously described, IHC staining was
performed for the mice plant tumor using anti
Ki67, anti-HORMAD1, and anti-p-NF-κB (p-p65)
antibodies. Two pathologists independently
assessed the results.
Cell culture
All human gastric cell lines were stored at the
Anhui Provincial Key Laboratory of Tumour
Immunotherapy and Nutrition Therapy. RPMI
1640 medium (RPMI 1640, Gibco, USA) was
used, and all cells were supplemented with
10% fetal bovine serum (FBS, Gibco, USA) and
2% penicillin/streptomycin (Trans Gen Biotech,
Beijing, China). For inhibition treatment, cul
tured cells were incubated with 10 μmol/L BAY-
117082 (Selleck, USA) for 48 h.
Lentivirus infection
The lentivirus expressing short hairpin RNA
(shRNA) targeting HORMAD1 was designed
and synthesized by Genechem (Shanghai, Chi
na). The lentivirus overexpressing HORMAD1
was designed and synthesized by Genechem
(Shanghai, China). The sh-RNA target sequence
is described in Supplementary Table 1. The effi
ciency of the lentivirus infection was validated
using western blot and qRT-PCR.
RNA extraction and RT-qPCR analysis
Total RNA was isolated from the tissues and
cells using an RNA extraction kit (Analytik Jena,
Germany) for qRT-PCR. The complementary
DNA (cDNA) was reverse transcribed using
the Trans-Script All-in-One First-Strand cDNA
Synthesis kit (Trans Gen Biotech, Beijing). The
analysis was performed using Green qPCR
Super Mix kits (Trans Gen Biotech, Beijing). The
primer sequences used in this study are listed
in Supplementary Table 2.
Western blotting (WB) analysis
Total protein was extracted from the cells and
tissues using the RIPA buffer. The cell and con
trol nuclear and cytoplasmic protein extracts
were prepared using nuclear and cytoplasmic
protein extraction kits. Protein concentrations
were detected using BCA kits and heated at
97°C for 10 min. The heated proteins were sep
arated on a 10% SDS-PAGE gel and transferred
to polyvinylidene difluoride (PVDF) membranes.
These membranes were then incubated for 15
min at room temperature with a protein-free
rapid-blocking buffer. Subsequently, the blots
were incubated with HORMAD1, CyclinD1,
E-cadherin, p21, vimentin, c-Myc, NF-κB (p65),
phospho-NF-κB (p-p65), phospho-IκBα, IκBα,
phospho-Iκκ-β, Iκκ-β, β-actin, and GAPDH pri
mary antibodies at 4°C overnight. After wash
ing with TBST, membranes were hybridized with
an appropriate secondary antibody at room
temperature for 1 h. Finally, images of the WB
bands were obtained using ChemiCapture, and
the intensity in each group was measured using
ImageJ software. GAPDH and β-actin were used
as internal controls. The antibodies in this study
are shown in the Supplementary Table 3.
Cell counting kit 8 (CCK-8) assay
For the CCK-8 assay, stably transfected cells
were seeded in 96-well plates at a density of
2,000 cells per well after various treatments.
The absorbance was measured at 450 nm.
Colony formation
The stably transfected cells were plated into
6-well plates and cultured in a medium contain
ing 10% FBS and 2% penicillin/streptomycin;
the medium was changed every 2-3 days. After
10-14 days, if colonies were observed, the HORMAD1 promotes gastric cancer progression
5811
Am J Transl Res 2023;15(9):5808-5825
plates were washed with PBS, and the cells
were fixed and stained with crystal violet for 20
min. After that, cells were observed under a
microscope (BX51; OLYMPUS, Japan).
EDU assay
EDU staining was conducted using the Beyo
Click™ EdU Cell Proliferation Kit with Alexa
Fluor 594 (Beyotime Biotechnology, China) per
the manufacturer’s instructions. Images were
acquired using a fluorescence microscope
(BX51; OLYMPUS, Japan) and quantified using
ImageJ software.
Cell migration and invasion assay
The invasive potential of the GC cells was mea
sured using Matrigel (BD, Franklin Lakes, NJ,
USA) and transwell inserts (8 μm, Costar, Ma
nassas, VA, USA) containing polycarbonate fil
ters with 8-μm pores. The inserts were coated
with 50 μl of 1 mg/ml Matrigel matrix according
to the manufacturer’s instructions. Images
were acquired using a fluorescence microscope
and quantified using ImageJ software.
Xenograft tumor formation assay
All animal experiments were approved and
were performed on 12 five-week-old male
BALB/c nude mice that were purchased from
the Laboratory Animal Centre of Anhui Medical
University. Moreover, the MKN-45 cells were
stably transfected with NC-shRNA or HORMAD1-
shRNA. Subsequently, 0.1 ml MKN-45 cells
(2×107 cells/ml) were subcutaneously injected
into the right and left sides of the abdomen
of each nude mouse. The mice were randomly
distributed to the NC-shRNA and HORMAD1-
shRNA groups (n = 6). Tumour volume was
measured every 3 days for 30 days and calcu
lated using the following formula: volume =
(Length × Width2)/2. The tumor tissues were
weighed, and IHC staining was used to identify
tissue sections expressing Ki-67, HORMAD1,
and p-p65. All animal experiments followed the
institutional guidelines and were approved by
the experimental Animal Ethics Committee of
USTC (No. 2021-N(A)-258).
Statistical analysis
All experiments were repeated three times.
Statistical analyses were conducted using
SPSS 23.0, and the results were visualized
using GraphPad Prism 8.0 (V8, USA). Student’s
t-test (two-tailed) or one-way ANOVA was used
to compare the means of two or three groups,
whereas the correlation between HORMAD1
expression and clinicopathological variables
was calculated using either the chi-square or
Fisher’s exact test. Spearman’s correlation
analysis was used to evaluate the correlation
between HORMAD1 and p-p65. Statistical sig
nificance was set at P < 0.05.
Results
HORMAD1 is upregulated in GC tissues
To explore the unique genes contributing to GC
progression, RNA-seq analysis was performed
using total RNA isolated from seven GC sam
ples and seven paired matched adjacent nor
mal tissues; 1,894 upregulated and 167 down
regulated genes were identified using threshold
fold change > 1.0 and P < 0.05. These samples
were further classified into three subgroups:
tumor vs matched adjacent tissues (n = 7), high
differentiated tumor vs matched adjacent tis
sues (n = 4), and low differentiated tumor vs
matched adjacent tissues (n = 3). Of these
screened genes, 823 crossover upregulated
genes were selected for further study, including
HORMAD1, KLK5, MAGEA10, CST1, HOXC-10,
MUC-2, DKK4, REG3G, POU3F3, and SERPINB4
(Figure 1A). Subsequently, following differential
gene expression analysis between the three
groups and upstream gene set enrichment
analysis, Gene Ontology (GO) enrichment analy
sis indicated that the most abundant biological
processes mainly included epithelial-mesen
chymal cell proliferation and migration process
es (Figure 1B). Regarding cellular components,
the most enriched categories included “junc
tion” and “passive transmembrane transporter
activity” (Figure 1C). Next, functional enrich
ment of differential gene expression (DEGs)
was performed using the Kyoto Encyclopaedia
of Genes and Genomes (KEGG) pathway analy
sis and Gene Ontology (GO) terminology analy
sis. KEGG analysis showed that these differ
entially expressed genes were significantly
enriched in multiple cancer-related signaling
pathways, such as metabolism-related and
focal adhesion-related pathways (Figure 1D).
Consistent with these findings, Gene SetHORMAD1 promotes gastric cancer progression
5812
Am J Transl Res 2023;15(9):5808-5825
Enrichment analysis (GSEA) revealed that the
epithelial-mesenchymal transition signatures,
the interferon alpha response, and TNF-α via
NF-κB signaling were more represented in the
GC tissues than in the adjacent tissues (Figure
1E).
Figure 1. HORMAD1 was upregulated in GC tissues by RNA-seq. A. Venn diagrams show the overlap between the dif
ferentially expressed genes (P < 0.05) from GC and adjacent tissues (n = 7) with low differentiation tumour group vs
matched adjacent samples and high differentiation tumour group (n = 4) vs matched adjacent samples for upregu
lated clusters. B, C. GO enrichment analysis of DEGs was mainly related to regulating epithelial cell proliferation,
migration, and mesenchymal cell differentiation and development. D. KEGG pathway enrichment analysis of DEGs
was mainly related to focal adhesion based on the high-throughput RNA sequencing database. E. GSEA analysis
revealed that HORMAD1 was mainly related to epithelial-mesenchymal transition and TNF-α and NF-κB signaling
and interferon-gamma response based on a high-throughput RNA sequencing database. mRNAs.HORMAD1 promotes gastric cancer progression
5813
Am J Transl Res 2023;15(9):5808-5825
HORMAD1 overexpression was associated
with clinicopathological characteristics in GC
Firstly, we analyzed HORMAD1 expression in
34 types of human cancer. HORMAD1 was
upregulated in 33 cancer types and markedly
increased in 12 cancer types compared with
levels in normal tissues (Figure 2A). Sub
sequently, we analyzed TCGA cohort and found
that HORMAD1 expression was significantly
higher in 375 gastric adenocarcinoma tissues
than in 34 adjacent normal tissues (Figure
2B). Next, we first used RT-qPCR to confirm
HORMAD1 expression in GC to examine
HORMAD1 mRNA levels in 46 GC and adjacent
tissues. We observed significant upregulation
of HORMAD1 in GC tissues compared to adja
cent tissues (Figure 2C). Furthermore, Kaplan
Meier survival analysis showed that patients
with highly-expressed HORMAD1 had signifi
cantly lower post-progression survival (P <
0.01) and relapse-free survival (P < 0.05) rates
than patients with low-expressed HORMAD1
(Figure 2D, 2E). To further validate HORMAD1
protein levels in GC, we detected HORMAD1 in
GC tissue containing seven gastric tumor tis
sues and corresponding adjacent tissues by
western blot. Similarly, HORMAD1 protein was
significantly increased in GC samples com
pared to adjacent tissues (Figure 2H). We
examined a small cohort of 46 pairs of GC and
paired adjacent tissues using IHC analysis.
Expression patterns of HORMAD1 in GC and
adjacent tissues were classified according to
IHC scores, and detailed demographic and clin
icopathological parameters of these patients
are presented in Table 1. GC tissues tended
to show stronger cytoplasmic staining of
HORMAD1, and adjacent tissues exhibited
a lower or negative expression of HORMAD1
(Figure 2F). Subsequently, we analyzed the
relationship between HORMAD1 expression
with cancer subtypes and clinicopathological
features. Elevated HORMAD1 expression was
detected in tumor samples with larger tumor
sizes and in older patients (Table 1). Moreover,
patients with advanced GC showed higher lev
els of HORMAD1 expression than patients with
early-stage GC. Overall, we found that increased
HORMAD1 expression was associated with age
(P < 0.01), tumor volumes (P < 0.01), and TNM
stage (P < 0.01) but not with sex, differentia
tion, or lymph node metastases. Ultimately,
these results indicate that HORAMAD1 plays an
essential role in GC development and patholo
gy. Meanwhile, we further revealed that
HORMAD1 was observed in GC cell lines com
pared to the healthy gastric epithelial GES-1
cell line according to our western blotting
and RT-qPCR results. We also observed that
HORMAD1 was highly expressed in MKN-45
and AGS cells and less expressed in MKN-74
and HCG-27 cells (Figure 2G, 2I). These results
indicate that HORMAD1 is frequently upregu
lated in GC and may function as a tumor-pro
moting factor in human GC.
HORMAD1 promotes proliferation, migration,
and invasion of GC cells in vitro
To determine whether HORMAD1 affects GC
cell proliferation, we transduced MKN-45 and
AGS cell lines with shRNAs targeting HORMAD1
or controls. We knocked down HORMAD1 effi
ciency using selected shRNA-1 and shRNA-2
from four distinct shRNAs in MKN-45 and AGS
cells confirmed by western blot and RT-qPCR
analysis (Figure 3A-D). Next, we used CCK-8,
colony formation, and EDU assays to detect cell
proliferation, colony formation capacity, and
DNA synthesis. Compared with control cells,
the proliferation rate (MKN-45-sh-HORMAD1,
P < 0.001; AGS-sh-HORMAD1, P < 0.001) and
the number of colony formations (MKN-45-sh
HORMAD1, P < 0.001; AGS-sh-HORMAD1 P <
0.001) of GC cells were significantly reduced
(Figure 3E-G). Subsequently, EDU was per
formed to assess the effect of sh-HORMAD1
on DNA synthesis in AGS and MKN-45 cells
(Figure 3I, 3J). The results showed that HOR
MAD1 downregulation inhibited cell growth in
both cells. Conversely, HORMAD1-overexpress
ing plasmids were introduced into HCG-27 and
MKN-74 cells, and HORMAD1 expression was
confirmed by RT-qPCR and western blot as
say (Figure 4A, 4B). We found that ectopic
HORMAD1 expression significantly promoted
HCG-27 and MKN-74 cell proliferation, colony
formation capacity and viability compared to
the empty vector (Figure 4C-E, 4H, 4I). Fur
thermore, to investigate the role of HORMAD1
in GC migration and invasion, we observed that
ectopic overexpression of HORMAD1 resulted
in significantly increased migration and inva
sion of HCG-27 and MKN-74 cells (Figure 4F,
4G). Conversely, HORMAD1 depletion in MKN-
45 and AGS cells significantly reduced cell mi
gration and invasion (Figure 3H). These results
suggest that HORMAD1 is associated with GC
cell proliferation, migration, and invasion. HORMAD1 promotes gastric cancer progression
5814
Am J Transl Res 2023;15(9):5808-5825
Figure 2. Expression of HORMAD1 and the prognostic role of HORMAD1 mRNA expression in GC. A. Expression of
HORMAD1 across 34 cancer types and the corresponding normal tissues using data from The Cancer Genome
Atlas (TCGA) database. Data were analyzed using the Wilcoxon test. B. HORMAD1 mRNA levels in gastric tissues
(n = 373) and adjacent normal tissues (n = 34) were assessed using the online TCGA database. C. Relative mRNA
expression of HORMAD1 was analyzed using RT-qPCR in tumor tissues and matched adjacent normal tissues
(n = 46). GAPDH was used for the normalization of RT-qPCR results (***P < 0.001). D, E. The effect of HORMAD1
mRNA expression in GC tissue on patient’s overall relapse-free survival and post progression survival was assessed
based on the database of the Kaplan-Meier plotter platform. F. HORMAD1 protein expression is significantly higher
in GC than in the matched normal tissues by IHC staining. IHC score analysis for HORMAD1 expression in 46 GC HORMAD1 promotes gastric cancer progression
5815
Am J Transl Res 2023;15(9):5808-5825
tissues compared with that in the matched normal tissues (**P < 0.01). G. RT-qPCR analysis of HORMAD1 mRNA
expression in gastric cell lines (MKN-45 vs GES-1, AGS vs GES-1, ***P < 0.001). H. WB analysis of HORMAD1 in
seven pairs of GC (T) and the matched adjacent (N) tissues (n = 7). I. WB analysis of HORMAD1 protein expression
in gastric cell lines. The number indicates the relative band intensity of HORMAD1 protein normalized against that
of β-actin. Representative images and statistical plots are shown in the upper and lower panels, respectively. IHC,
immunohistochemistry; GC, gastric cancer.
Table 1. Correlation between HORMAD1 expression and clinicopathologic characteristics in 46 gastric
cancer patients
Clinicopathological features
Category
HORMAD1 expression (%)
χ2
p value
High (> 6)
Low (< 6)
Total
46
Age
10.435
0.004
< 53
8
2
6
≥ 53
38
31
7
Sex
0.023
0.347
Male
36
28
8
Female
10
8
2
Tumor size
3.622
0.007
< 5
8
4
4
≥ 5
38
31
7
Location
5.895
0.752
GEJ-Cardia
30
19
11
Fundus-Body
9
2
7
Antrum-Pylorus
6
4
2
Remnant + multi-sites
1
1
0
Lauren type
1.759
0.193
Intestinal
36
26
10
Diffuse + mixed
10
5
5
pT stage
18.892
0.150
T1 + T2
15
2
13
T3 + T4
31
25
6
pN stage
0.810
0.955
N0
9
6
3
N1
12
8
4
N2
14
10
4
N3
11
6
5
M stage
0.378
0.601
M0
44
31
13
M1
2
1
1
TNM stage
10.388
0.0001
I + II
9
2
7
III + IV
37
29
8
HORMAD1 promotes GC progression in xeno
graft mouse models
To study the in vivo function of HORMAD1 in GC
tumor growth, we used a subcutaneous xeno
graft tumor model, wherein MKN-45 GC cells
(2×107) were injected into the right flank of
mice. Thirty days post-transplantation, we
observed that tumors derived from control
MKN-45 cells were significantly larger in size
when compared to those from HORMAD1-de
pleted cells (Figure 5A). Furthermore, tumors HORMAD1 promotes gastric cancer progression
5816
Am J Transl Res 2023;15(9):5808-5825
formed in the control group had a larger tumor
volume and heavier weight than those in the
sh-HORMAD1 group (Figure 5B, 5C). Further
more, the IHC results showed that tumors dis
sected from the sh-NC group exhibited a stron
ger HORMAD1 staining than those from the sh
HORMAD1 group. Meanwhile, IHC analysis con
firmed that sh-HORMAD1 inhibited the expres
sion of the proliferation marker Ki-67 (Figure
5F). Moreover, tumors derived from sh-HOR
Figure 3. Knockdown of HORMAD1 inhibits cell proliferation and colony formation. A-D. WB and RT-qPCR analysis of
the transfection efficiency of sh-HORMAD1 in MKN-45 and AGS cells (**P < 0.01 vs sh-NC). E, F. Cell proliferation
activities of sh-HORMAD1-transfected MKN-45 and AGS cells were measured using CCK8 analysis (*P < 0.05 vs
NC; **P < 0.01 vs NC). G. Analysis of cell colony formation capacity of sh-HORMAD1-transfected MKN-45 and AGS
cells (**P < 0.01 vs NC). H. The cells’ invasive and migration potential was assessed using the Transwell assay in
sh-HORMAD1 transfected MKN-45 and AGS cells (**P < 0.01 vs sh-NC). All histograms represent the results of
three independent experiments. I, J. The EDU assay was used to observe the effects of HORMAD1 knockdown on
the DNA synthesis of MKN-45 and AGS cells.HORMAD1 promotes gastric cancer progression
5817
Am J Transl Res 2023;15(9):5808-5825
MAD1 with MKN-45 cells had lower levels of
p-NF-κB/p65 proteins than sh-NC cells by
western blot and IHC analysis (Figure 5D).
Furthermore, Pearson’s analysis showed that
p-p65 protein levels were positively correlated
with HORMAD1 in xenograft tissues (Figure
5E). We confirmed this phenomenon in GC
by assessing the p-p65 expression in GC
and adjacent tissues. As shown in Figure 5H,
p-p65 expression was stronger in GC tissues
than in adjacent tissues. Furthermore, GC
tissues with high HORMAD1 expression had a
higher p-p65 expression than GC tissues with
low HORMAD1 expression (Figure 5G). Further,
Pearson’s analysis demonstrated that p-p65
protein levels were positively correlated with
HORMAD1 in GC tissues (Figure 5I). These
results suggest that HORMAD1 promotes
tumor growth, possibly through the NF-κB/p65
pathway.
Figure 4. Overexpression of HORMAD1 promotes cell growth and invasion. A, B. RT-qPCR analysis of the transfection
efficiency of HORMAD1 in MKN-74 and HCG-27 cells (**P < 0.01 vs OE-NC). C-E. Cell proliferation activity and colony
formation capability were estimated using CCK-8 and colony formation assays, respectively, in HORMAD1-transfect
ed MKN-74 and HCG-27 cells (**P < 0.01 vs OE-NC). F, G. Transwell invasion assay was performed to assess cell
invasive and migration potential in MKN-74 and HCG-27 cells overexpressing HORMAD1 (*P < 0.05 vs OE-NC, **P
< 0.01 vs OE-NC). H, I. The results of EdU assay effects on DNA synthesis of HGC-27, MKN74-cells. HORMAD1 promotes gastric cancer progression
5818
Am J Transl Res 2023;15(9):5808-5825
Figure 5. HORMAD1 knockdown inhibits GC tumor formation and growth in nude mice. A. Tumor xenografts were
generated using HORMAD1-silencing MKN-45 cells. Images of tumors are shown (n = 6). B. The tumors formed in
mice were surgically collected 30 days after the injection. Tumor tissues in sh-NC and sh-HORMAD1 groups were
weighed after 30 days. C. Tumor growth curve of the xenograft tumor growth tendency in the sh-HORMAD1 and NC
groups (**P < 0.01 vs sh-NC). D. Protein levels of HORMAD1, phospho-NF-κB (p-p65), p65, and GAPDH in tumor
tissues were measured using western blotting assay of sh-HORMAD1 groups vs sh-NC (n = 6). E. Positive correla
tion between the expression level of HORMAD1 and the level of phosphorylated NF-κB (S473) by IHC in nude mice
xenograft gastric tumors (**P < 0.01 vs sh-NC). F. Representative photomicrographs of IHC staining of HORMAD1,
p-p65, and Ki-67 in GC nude mice tissues (Magnification: ×200). G. Percentages of specimens showing low or high
HORMAD1 expression relative to the levels of p-p65. H. Significantly higher expression of p-p65 protein was ob
served in GC tissues compared with that in matched normal tissues, as indicated by IHC staining. IHC score analysis
of p-p65 expression in 46 GC tissues revealed a significant difference (***P < 0.001) compared to that in matched
normal tissues. I. Pearson’s correlation coefficient (r) was calculated to assess the correlation between HORMAD1
and p-p65 in the 46 pairs of GC tissues.HORMAD1 promotes gastric cancer progression
5819
Am J Transl Res 2023;15(9):5808-5825
HORMAD1 enhances the activity of the NF-κB
signaling pathway
To further explore the molecular mechanism by
which HORMAD1 promotes GC development,
we analyzed differentially upregulated gene
expression in 237 and 112 downregulated
genes in MKN-45 sh-HORMAD1 cells using
RNA sequencing. We found that HORMAD1
silencing significantly regulated the expression
of 349 genes in MKN-45 cells (log2 ratio > 1
or < -1, P < 0.05), containing 112 downregulat
ed and 237 upregulated mRNAs in HORMAD1-
silenced GC cells, compared to that in the nega
tive control groups (Figure 6A, 6B). KEGG cate
gorization significantly enriched these differen
tially expressed genes in multiple cancer-relat
ed signaling pathways, including NF-κB and
TNF-α as the top-ranked signaling pathways
(Figure 6C). Furthermore, GSEA showed that
the NF-κB signaling pathway was strongly
enriched in the control group (Figure 6D).
Based on RNA-seq results, western blotting
confirmed that HORMAD1 knockdown in MKN-
45 cells decreased NF-κB activity. Notably,
NF-κB activation requires translocation of the
p65 subunit from the cytoplasm to the nucleus,
during which IKK-β is a key kinase to facilitate
translocation by releasing the p65 subunit
from IκB-α. Therefore, we investigated whe
ther HORMAD1 affects the status of Iκκ-β and
IκB-α in GC cells. The results suggested that
HORMAD1 knockdown decreased the abun
dance of both p-Iκκ-β (atThr188) and p-IκB-α
(atSer32), while total IKK-β and IκB-α levels
were unchanged (Figure 6E). Overall, these
findings suggested HORMAD1 plays a role in
transactivating the NF-κB signaling pathway.
HORMAD1 promoted EMT and proliferation in
gastric cancer cells
Because EMT is considered a prominent fea
ture of most cancers and plays a crucial role in
cancer progression and invasion, it was worth
investigating whether HORMAD1 was involved
in regulating the EMT process of GC cells.
Therefore, by western blotting assay, we exam
ined EMT markers in HORMAD1 overexpressed
in HCG-27 and MKN-74 cells. The data revealed
the downregulation of the cohesive epithelial
marker E-cadherin and a corresponding upreg
ulation of the mesenchymal markers Vimentin
and N-cadherin upon HORMAD1 overexpres
sion (Figure 6F). As shown in (Figure 6G),
HORMAD1 knockdown exerted the opposite
effect in MKN-45 and AGS cells. Furthermore,
we found that HORMAD1 could enhance NF-κB
downstream proliferation-related gene expres
sion. Moreover, the HORMAD1 knockdown gr
oup showed the downregulation of c-Myc and
CyclinD1 and the upregulation of p21, whereas
the HORMAD1 overexpressed group showed
the opposite (Figure 6F, 6G). Thus, the function
al changes induced by HORMAD1 suggest that
HORMAD1 may be an important facilitator of
EMT and proliferation in GC.
HORMAD1 facilitates the GC progression
through the NF-κB signaling pathway
To determine whether HORMAD1 promotes
proliferation and invasion of GC cells via the
NF-κB signaling pathway, we treated HORMAD1-
overexpressed MKN-74 cells with the IKK inhib
itor Bay-117082 (20 µmol/l) for 2 h. Compar
ed to Dimethyl sulfoxide (DMSO), Bay-117082
treatment resulted in a significant reduction in
cell proliferation (P < 0.001) and colony forma
tion (P < 0.001) in MKN-74-HORMAD1 cells
(Figure 7A-C). Similarly, migration and invasion
assays showed that MKN-74-HORMAD1 cells
treated with IKK inhibitor showed reduced inva
sion capacity compared to the DMSO group
(Figure 7D) (P < 0.001). To ascertain whether
EMT mediates the role of HORMAD1 in the
migration and invasion of GC cells, we treated
MKN-74 cells with Bay-117082; the results of
the western blot assay showed that it was
possible to rescue the expression changes
of E-cadherin, N-cadherin, and Vimentin upon
HORMAD1 overexpression (Figure 7E). In short,
EMT was partly responsible for the promotion
effect of HORMAD1 on the migration and inva
sion of GC cells. Furthermore, we characterized
the signaling mechanism by which HORMAD1
regulates the NF-κB signaling pathway in GC
cells. Our results demonstrated that overex
pression of HORMAD1 increased Ser32 phos
phorylation of IκB-α and Thr188 phosphoryla
tion of Iκκ-β, which attenuated p-NF-κB degra
dation (p-p65) and promoted its nuclear trans
location (Figure 7F). In addition, the IKK inhibi
tor Bay-117082 partially restored increased
levels of p-Iκκ-β (Thr188) and p-IκB-α (atSer32),
accompanied by a partial reversal of HORM
AD1 overexpression-induced changes in p-NF-
κB (p-p65) expression levels and transcription-HORMAD1 promotes gastric cancer progression
5820
Am J Transl Res 2023;15(9):5808-5825
Figure 6. HORMAD1 is involved in the regulation of the NF-κB signaling pathway. A. Heatmap of the differentially ex
pressed genes from the RNA-seq experiment following HORMAD1 knockdown. Red and blue represent upregulation
and downregulation, respectively. B. The number of differentially expressed mRNAs. C. KEGG enrichment analysis
of the 10 most important enriched pathways regulating HORMAD1 in GC cells. Based on KEGG signaling pathways,
this analysis allowed for the functional categorization of differentially expressed mRNAs triggered by the knockdown
of HORMAD. D. GSEA analysis comparing the sh-HORMAD1 group (red) to the sh-control group (blue) of MKN-45 GC
transfect cells. E. Western blotting analysis of the expression of HORMAD1, p-p65, p65, p-Iκκ-β, Iκκ-β, p-IκB-α, IκB-α,
and GAPDH in the cochlea. GAPDH was used as an internal control (**P < 0.01 vs OE-NC, ***P < 0.001 vs sh-NC).
F. Western blot assay analysis of the expressions of EMT and proliferation relative gene (E-cadherin, N-cadherin, vi
mentin, p21, CyclinD1, and c-Myc) on HCG-27 and MKN-74 with overexpressed HORMAD1. G. Western blot analysis HORMAD1 promotes gastric cancer progression
5821
Am J Transl Res 2023;15(9):5808-5825
of the expression of EMT and proliferation related gene (E-cadherin, N-cadherin, vimentin, p21, CyclinD1, and c-Myc)
by HORMAD1 knockdown in MKN-45 and AGS cells. β-actin was used as an internal control.
Figure 7. HORMAD1 enhances GC cells’ proliferative and invasive abilities by the NF-κB signaling pathway. A. Rep
resentative image of the colony formation assay for MKN-74 cells transfected with HORMAD1 and their control cells
with DMSO or Bay117082 (**P < 0.01 vs DMSO, ***P < 0.001 vs DMSO). B. The number of colonies formed by
each group is shown in the histogram. C. The cell growth curve of MKN-74 cells transfected with HORMAD1 and
their control cells with DMSO or Bay117082 (**P < 0.01 vs DMSO). D. Representative images of the Matrigel in
vasion assay for MKN-74 cells transfected with HORMAD1 and their control cells with DMSO or Bay117082 (**P
< 0.01 vs DMSO, ***P < 0.001 vs DMSO). The invasive cell number for each group is shown in the histogram. E.
The MKN-74 cells with HORMAD1 overexpression were treated with Bay117082 for 48 h, then the protein levels of
EMT markers were measured by western blotting. F. HORMAD1-overexpressed or control MKN-74 cells were treated
with Bay117082 or DMSO for 2 h. Subsequently, the protein levels were measured by western blotting. Lamin B1
or GAPDH was used as an internal control (*P < 0.05 vs DMSO, **P < 0.01 vs DMSO, ***P < 0.001 vs DMSO).HORMAD1 promotes gastric cancer progression
5822
Am J Transl Res 2023;15(9):5808-5825
al activity. Therefore, we identified that Bay-
117082 treatment significantly inhibited p-NF-
κB (p-p65) and p-NF-κB (p-p65) nuclear trans
location induced by HORMAD1 overexpression
in MKN-74 cells, suggesting that HORMAD1-
mediated p-NF-κB activation is indeed in the
p-NF-κB/Iκκ-β pathway. These results demon
strated that HORMAD1 activates GC cell prolif
eration and invasion by regulating the activa
tion of the NF-κB signaling pathway.
Discussion
Previous studies have shown that HORMAD1,
a meiosis-specific protein, is widely expressed
in various cancer types, including lung, ova
rian, and breast cancer [13-17]. Furthermore,
HORMAD1 has been implicated in tumour
development and chemotherapeutic resist
ance. However, the precise biological functions
of HORMAD1 in GC progression and its underly
ing mechanisms remain unclear. This study
attempted to reveal the role and mechanisms
of HORMAD1 in GC progression. We identified a
significant increase in HORMAD1 expression in
GC tissues and cell lines. Specifically, high lev
els of HORMAD1 expression correlated with
poor prognosis, higher tumor stage, and incre
ased lymph node metastasis rates. Moreover,
we found that HORMAD1 facilitated the prolif
eration, migration, and invasion of gastric can
cer cells, consistent with previous research
[13, 17]. Interestingly, our study also showed
a positive association between HORMAD1
expression and p-NF-κB expression based on
IHC score analysis, confirmed by vivo experi
ments. Therefore, our findings strongly suggest
that HORMAD1 may act as an oncogenic gene
in GC’s development and progression.
The initial stage of metastatic progression
is essentially dependent on EMT [21, 22]. Spe
cifically, the activation of EMT allows cancer
cells to migrate and invade beyond the extra
cellular matrix of surrounding tissues in the
metastatic cascade [4]. During cancer progres
sion, EMT can alter the adhesion of epithelial
cancer cells and allow them to invade and
migrate to distant sites, thus contributing to
tumor metastasis [23]. Recent studies have
highlighted the role of CTAs in promoting tumor
metastasis through the induction of EMT. For
instance, Testes-specific protease 50 (TSP50)
has been shown to promote invasion and meta
stasis in GC by inducing EMT [24]. Moreover,
studies showed that HORMAD1 promotes EMT
and metastasis through the Wnt/β-catenin
pathway [13]. To date, no studies have investi
gated the role of HORMAD1 (CTA46) as a CTAs
in EMT and tumor progression in GC. Moreover,
the mechanism underlying its pathogenesis is
rather lacking evidence. In this context, our
study provided mechanistic evidence support
ing HORMAD1’s vital role in promoting EMT and
proliferation in GC. We report that HORMAD1-
knockdown GC cells have low levels of Vimen
tin, N-Cadherin, and c-Myc and high levels of
E-cadherin, suggesting that HORMAD1 is a
potent inducer of EMT, resulting in more inva
sive and proliferation biological behavior in GC
cells.
It is well known that the NF-κB signaling path
way is involved in cell migration and invasion
and plays a key role in promoting and maintain
ing the invasiveness of cancer cells via regulat
ing EMT processes in different tumors, includ
ing GC [6, 25]. Multiple lines of evidence have
implicated the NF-κB signaling pathway in regu
lating various pathophysiological processes,
including inflammation, malignant transforma
tion, transcription, cell apoptosis, metastasis,
and proliferation [26]. Furthermore, a previous
study showed that NF-κB is required for TSP50-
induced migration and invasion of breast can
cer cells [27]. Moreover, NF-κB/p65, as a tran
scription factor involved in EMT or proliferation,
has been reported to play an important role
in tumors. However, the effect of HORMAD1
on NF-κB in GC has not been investigated.
Therefore, based on our RNA-seq results of
GSEA and KEGG analysis, it is strongly sug
gested that the NF-κB pathway is highly rele
vant to HORMAD1. Moreover, identifying and
understanding specific modulators regulating
the NF-κB pathway in GC cells could offer new
insights into the molecular mechanisms under
lying EMT and potentially lead to the discovery
of novel therapeutic targets for GC. This stu
dy revealed that HORMAD1 promotes p-p65
expression by increasing cytoplasmic accumu
lation and subsequent nuclear translocation,
leading to NF-κB signaling activation. It is well
known c-Myc as an oncogene in several carci
nogenesis processes, which are involved in cell
proliferation and growth, cell cycle regulation,
cell adhesion, metabolism, ribosome biogene
sis, protein synthesis, and mitochondrial func-HORMAD1 promotes gastric cancer progression
5823
Am J Transl Res 2023;15(9):5808-5825
tion [28, 29]. Several studies showed that
c-Myc can promote the growth and proliferation
of gastric cancer cells and help them maintain
malignant phenotype [30, 31]. Meanwhile,
CyclinD1 acts as a growth factor drives cell
cycle progression and promote cell prolifera
tion in many different types of cancer [32].
Previous studies have indicated that CyclinD1
as a key cell cycle-related molecules are
involved in the occurrence and progression of
GC [33]. Consistent with our finding, upregula
tion of HORMAD1 was observed to increase
the expression of CyclinD1 and c-Myc while
decreasing the expression of p21. Conversely,
the knockdown of HORMAD1 reversed these
effects, resulting in decreased expression of
CyclinD1 and c-Myc and increased expression
of p21. Notably, both c-Myc and CyclinD1 play
important roles in cell proliferation.
We report that HORMAD1 induces malignant
phenotypes in GC cells by activating the NF-κB
pathway in GC cells. Our results demonstrate
that HORMAD1 overexpression increases the
phosphorylation of NF-κB (Ser536) and Iκκ-β
(Thr188), which promotes its nuclear transloca
tion. Moreover, the Iκκ-β inhibitor partially re
duced the levels of p-NF-κB and p-Iκκ-β, which
were initially inhibited by HORMAD1 knock
down. Furthermore, treatment of HORMAD1-
overexpressing cells with the specific Iκκ-β
inhibitor, BAY-117082, partially restored the
levels of p-NF-κB (Ser536) and transcriptional
activity of NF-κB. Meanwhile, the treatment
with Iκκ-β inhibitor, BAY-117082, partly res
tored the level of EMT markers in HORMAD1-
overexpressed MKN-74 cells. These above
results indicate that HORMAD1 overexpression
activates the NF-κB signaling pathway, thus
promoting EMT in GC cells. These findings
collectively demonstrate the upregulation of
HORMAD1 in GC and its promotion of GC prolif
eration. Additionally, HORMAD1 was found to
partially regulate the EMT process by activating
the NF-κB signaling pathway. Until now, the role
of HORMAD1 in gastric cancer still has some
limitations. Accordingly, in our present finding
provides an effective strategy and potential the
therapeutic target for GC. Moreover, we specu
lated that GC patients with high HORMAD1
expression may benefit more from treatment
with inhibitors of the NF-κB pathway, which pro
vide novel insights that could be used to
improve the clinical efficacy of these inhibitors.
However, our research has not been adequate
ly verified, therefore, comprehensive research
is needed to confirm the regulated mechanism
remain to be investigated in the future.
Acknowledgements
This work was supported by the Fundamental
Research Funds for the Central Universities
(No. WK9110000064), Anhui Provincial Natural
Science Foundation (No. 2208085QH228) and
Anhui Provincial Natural Science Foundation
(2208085QH230). The Special Support for the
Anhui Provincial Project of the Key Laboratory
of Tumor Immunotherapy and Nutrition Therapy
(2019b12030026).
Disclosure of conflict of interest
None.
Address correspondence to: Dr. Ping Li, Department
of Chinese Integrative Medicine Oncology, The First
Affiliated Hospital of Anhui Medical University, No.
120 Wanshui Road, Hefei 230022, Anhui, China.
Tel: +86-0551-65908527;
E-mail: liping1964@
ahmu.edu.cn
References
[1] Rawla P and Barsouk A. Epidemiology of gas
tric cancer: global trends, risk factors and pre
vention. Prz Gastroenterol 2019; 14: 26-38.
[2] Bray F, Ferlay J, Soerjomataram I, Siegel RL,
Torre LA and Jemal A. Global cancer statistics
2018: GLOBOCAN estimates of incidence and
mortality worldwide for 36 cancers in 185
countries. CA Cancer J Clin 2018; 68: 394-
424.
[3]
Patel TH and Cecchini M. Targeted therapies in
advanced gastric cancer. Curr Treat Options
Oncol 2020; 21: 70.
[4] Lu W and Kang Y. Epithelial-mesenchymal
plasticity in cancer progression and metasta
sis. Dev Cell 2019; 49: 361-374.
[5] Dolcet X, Llobet D, Pallares J and Matias-Guiu
X. NF-kB in development and progression of
human cancer. Virchows Arch 2005; 446: 475-
482.
[6]
Mirzaei S, Saghari S, Bassiri F, Raesi R, Zarrabi
A, Hushmandi K, Sethi G and Tergaonkar V. NF-
κB as a regulator of cancer metastasis and
therapy response: a focus on epithelial-mesen
chymal transition. J Cell Physiol 2022; 237:
2770-2795.
[7] Ji J, Ding K, Luo T, Zhang X, Chen A, Zhang D, Li
G, Thorsen F, Huang B, Li X and Wang J. HORMAD1 promotes gastric cancer progression
5824
Am J Transl Res 2023;15(9):5808-5825
TRIM22 activates NF-κB signaling in glioblas
toma by accelerating the degradation of IκBα.
Cell Death Differ 2021; 28: 367-381.
[8] Kunnumakkara AB, Diagaradjane P, Guha S,
Deorukhkar A, Shentu S, Aggarwal BB and
Krishnan S. Curcumin sensitizes human
colorectal cancer xenografts in nude mice to
gamma-radiation by targeting nuclear factor
kappaB-regulated gene products. Clin Cancer
Res 2008; 14: 2128-2136.
[9] Le F, Zhang JY, Liu W, Huang XM and Luo WZ.
The levels of NF-κB p50 and NF-κB p65 play a
role in thyroid carcinoma malignancy in vivo. J
Int Med Res 2018; 46: 4092-4099.
[10] Kanarek N and Ben-Neriah Y. Regulation of NF-
κB by ubiquitination and degradation of the
IκBs. Immunol Rev 2012; 246: 77-94.
[11] Hayden MS and Ghosh S. NF-κB, the first quar
ter-century: remarkable progress and out
standing questions. Genes Dev 2012; 26:
203-234.
[12] Liu K, Wang Y, Zhu Q, Li P, Chen J, Tang Z, Shen
Y, Cheng X, Lu LY and Liu Y. Aberrantly ex
pressed HORMAD1 disrupts nuclear localiza
tion of MCM8-MCM9 complex and compromis
es DNA mismatch repair in cancer cells. Cell
Death Dis 2020; 11: 519.
[13] Liu K, Cheng L, Zhu K, Wang J and Shu Q. The
cancer/testis antigen HORMAD1 mediates ep
ithelial-mesenchymal transition to promote tu
mor growth and metastasis by activating the
Wnt/β-catenin signaling pathway in lung can
cer. Cell Death Discov 2022; 8: 136.
[14] Gao Y, Kardos J, Yang Y, Tamir TY, Mutter-Rott
mayer E, Weissman B, Major MB, Kim WY and
Vaziri C. The Cancer/Testes (CT) antigen HOR
MAD1 promotes homologous recombinational
DNA repair and radioresistance in lung adeno
carcinoma cells. Sci Rep 2018; 8: 15304.
[15] Nichols BA, Oswald NW, McMillan EA, McGlynn
K, Yan J, Kim MS, Saha J, Mallipeddi PL,
LaDuke SA, Villalobos PA, Rodriguez-Canales J,
Wistuba II, Posner BA, Davis AJ, Minna JD,
MacMillan JB and Whitehurst AW. HORMAD1 is
a negative prognostic indicator in lung adeno
carcinoma and specifies resistance to oxida
tive and genotoxic stress. Cancer Res 2018;
78: 6196-6208.
[16] Tarantino D, Walker C, Weekes D, Pemberton
H, Davidson K, Torga G, Frankum J, Mendes
Pereira AM, Prince C, Ferro R, Brough R, Pettitt
SJ, Lord CJ, Grigoriadis A and Nj Tutt A. Func
tional screening reveals HORMAD1-driven
gene dependencies associated with transle
sion synthesis and replication stress toler
ance. Oncogene 2022; 41: 3969-3977.
[17] Shahzad MM, Shin YH, Matsuo K, Lu C,
Nishimura M, Shen DY, Kang Y, Hu W, Mora
EM, Rodriguez-Aguayo C, Kapur A, Bottsford
Miller J, Lopez-Berestein G, Rajkovic A and
Sood AK. Biological significance of HORMA do
main containing protein 1 (HORMAD1) in epi
thelial ovarian carcinoma. Cancer Lett 2013;
330: 123-129.
[18] El-Botty R, Vacher S, Mainguené J, Briaux A,
Ibadioune S, Dahmani A, Montaudon E, Nema
ti F, Huguet L, Sourd L, Morriset L, Château
Joubert S, Dubois T, Maire V, Lidereau R, Rapi
nat A, Gentien D, Coussy F, Bièche I and
Marangoni E. HORMAD1 overexpression pre
dicts response to anthracycline-cyclophospha
mide and survival in triple-negative breast can
cers. Mol Oncol 2023; [Epub ahead of print].
[19] Aung PP, Oue N, Mitani Y, Nakayama H, Yoshi
da K, Noguchi T, Bosserhoff AK and Yasui W.
Systematic search for gastric cancer-specific
genes based on SAGE data: melanoma inhibi
tory activity and matrix metalloproteinase-10
are novel prognostic factors in patients with
gastric cancer. Oncogene 2006; 25: 2546-
2557.
[20] Seethala RR, Gooding WE, Handler PN, Collins
B, Zhang Q, Siegfried JM and Grandis JR. Im
munohistochemical analysis of phosphotyro
sine signal transducer and activator of tran
scription 3 and epidermal growth factor
receptor autocrine signaling pathways in head
and neck cancers and metastatic lymph
nodes. Clin Cancer Res 2008; 14: 1303-1309.
[21] Sánchez-Tilló E, Liu Y, de Barrios O, Siles L,
Fanlo L, Cuatrecasas M, Darling DS, Dean DC,
Castells A and Postigo A. EMT-activating tran
scription factors in cancer: beyond EMT and
tumor invasiveness. Cell Mol Life Sci 2012; 69:
3429-3456.
[22] Pastushenko I and Blanpain C. EMT transition
states during tumor progression and metasta
sis. Trends Cell Biol 2019; 29: 212-226.
[23] Spaderna S, Schmalhofer O, Hlubek F, Berx G,
Eger A, Merkel S, Jung A, Kirchner T and
Brabletz T. A transient, EMT-linked loss of
basement membranes indicates metastasis
and poor survival in colorectal cancer. Gastro
enterology 2006; 131: 830-840.
[24] Cao QH, Liu F, Li CZ, Liu N, Shu M, Lin Y, Ding L
and Xue L. Testes-specific protease 50 (TSP50)
promotes invasion and metastasis by inducing
EMT in gastric cancer. BMC Cancer 2018; 18:
94.
[25] Liu J, Wu Z, Han D, Wei C, Liang Y, Jiang T, Chen
L, Sha M, Cao Y, Huang F, Geng X, Yu J, Shen Y,
Wang H, Feng L, Wang D, Fang S, Wang S and
Shen Y. Mesencephalic astrocyte-derived neu
rotrophic factor inhibits liver cancer through
small ubiquitin-related modifier (SUMO)ylation
related suppression of NF-κB/snail signaling
pathway and epithelial-mesenchymal transi
tion. Hepatology 2020; 71: 1262-1278.HORMAD1 promotes gastric cancer progression
5825
Am J Transl Res 2023;15(9):5808-5825
[26] Sheppard KA, Rose DW, Haque ZK, Kurokawa
R, McInerney E, Westin S, Thanos D, Rosenfeld
MG, Glass CK and Collins T. Transcriptional ac
tivation by NF-kappaB requires multiple coacti
vators. Mol Cell Biol 1999; 19: 6367-6378.
[27] Song ZB, Ni JS, Wu P, Bao YL, Liu T, Li M, Fan C,
Zhang WJ, Sun LG, Huang YX and Li YX. Testes
specific protease 50 promotes cell invasion
and metastasis by increasing NF-kappaB-de
pendent matrix metalloproteinase-9 expres
sion. Cell Death Dis 2015; 6: e1703.
[28] Oster SK, Ho CS, Soucie EL and Penn LZ. The
myc oncogene: MarvelouslY complex. Adv Can
cer Res 2002; 84: 81-154.
[29] Calcagno DQ, Leal MF, Assumpcao PP, Smith
MA and Burbano RR. MYC and gastric adeno
carcinoma carcinogenesis. World J Gastroen
terol 2008; 14: 5962-5968.
[30] Zhang L, Hou Y, Ashktorab H, Gao L, Xu Y, Wu
K, Zhai J and Zhang L. The impact of C-MYC
gene expression on gastric cancer cell. Mol
Cell Biochem 2010; 344: 125-135.
[31] Shi Q, Wang W, Jia Z, Chen P, Ma K and Zhou C.
ISL1, a novel regulator of CCNB1, CCNB2 and
c-MYC genes, promotes gastric cancer cell pro
liferation and tumor growth. Oncotarget 2016;
7: 36489-36500.
[32] Liao DJ, Thakur A, Wu J, Biliran H and Sarkar
FH. Perspectives on c-Myc, Cyclin D1, and their
interaction in cancer formation, progression,
and response to chemotherapy. Crit Rev Oncog
2007; 13: 93-158.
[33] Arici DS, Tuncer E, Ozer H, Simek G and Koyun
cu A. Expression of retinoblastoma and cyclin
D1 in gastric carcinoma. Neoplasma 2009;
56: 63-67.HORMAD1 promotes gastric cancer progression
1
Supplementary Table 1. sh-RNA sh-HORMAD1 and primer sequences used in the study
Sh-NC
TTCTCCGAACGTGTCACGT
Sh-1
GAAGATGAACAGGAGCATTAT
Sh-2
GCATTCTCCTCATTCGCAAGA
Sh-3
GATCTACACAGTTAGTGAAAT
Supplementary Table 2. RT-qPCR Primer sequence
Gene
Primer F
Primer R
HORMAD1
5’-GCCCAGTTGCAGAGGACTC-3’
5’-TCTTGTTCCATAAGCGCATTCT-3’
GAPDH
5’-GAGTCAACGGATTTGGTCGT-3’
5’-GACAAGCTTCCCGTTCTCAG-3’
Supplementary Table 3. Western blot antibody in this study
Gene
Ratio
Brand
Art. NO
HORMAD1
1:1000
Proteintech
#13917
p21
1:1000
Proteintech
#10355
E-Cadherin
1:5000
Proteintech
#20874
N-cadherin
1:5000
Proteintech
#22018
Vimentin
1:1000
cst
#5741
c-Myc
1:1000
cst
#9402
CyclinD1
1:10000
Proteintech
#60186
MMP-9
1:500
ZenBio
#380831
NF-κB p65
1:500
cst
#13008
phospho-NF-κB p65
1:1000
cst
#3033
IκBα
1:1000
Proteintech
#10268
IKKβ
1:1000
Abcam
#ab32135
Phospho-IKKβ
1:1000
Immunoway
#YP0637
Phospho-IκBα
1:1000
Immunoway
#YP1372
打印 』※ 收藏此页 ※『 关闭

Copyright @ 2022 安徽中医肿瘤网 All Rights Reserved

网站信息仅供参考,不能作为诊断及医疗的依据!如果您怀疑自己有某种健康问题,请尽快去医院就诊治疗。